croitru7857 croitru7857

25-02-2018
Biology

contestada

The base sequence of the template strand of dna is cattggtaggcaaaagaact. what is the new synthesized complementary strand?

Respuesta :

Eric0422 Eric0422

25-02-2018

gtaaccatccgttttcttga

Answer Link

Otras preguntas

what is the new egg cell produced by fertilization called?

Can you answer them all

it takes 12.5g of kool-aid powder to make 5 liters of juice. how many grams of powder it will take to make 20.5 liters of juice?

6. How do we know that Nestor was extremely impressed that Telemachus was traveling with Athene?

can someone please help?

during the calvin cycle, carbon dioxide is _____ to drive the formation of sugars.

Marketing programs that track purchases history, personal information and preferences and provide incentives to loyal, repeat customers are called? A. loyalty

Which sentence from Last Lecture supports the idea that it's important to have far-reaching goals?

thuyết minh về cây bút bi

There are many ways to learn something, including in a classroom or on the job. What do you think? The best way to learn about something is by doing it. Agree D